Stem-loop sequence ssc-mir-32

AccessionMI0002443 (change log)
DescriptionSus scrofa miR-32 stem-loop
Gene family MIPF0000069; mir-32
Literature search

2 open access papers mention ssc-mir-32
(2 sentences)

Stem-loop
           ug     u           -  uu  c 
5' ggagauau  cacau acuaaguugca ug  gu a
   ||||||||  ||||| ||||||||||| ||  ||  
3' cuuuuaua  gugug ugauuuaacgu ac  cg c
           gu     -           g  uc  g 
Get sequence
Deep sequencing
1551 reads, 231 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 280645137-280645206 [-]
sense
ENSSSCT00000005988 ; TMEM245-201; intron 14
Database links

Mature sequence ssc-miR-32

Accession MIMAT0002149
Sequence

6 - 

uauugcacauuacuaaguugc

 - 26

Get sequence
Deep sequencing1523 reads, 13 experiments
Evidence by similarity; MI0000090

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).