Accession | MIMAT0002173 |
Description | hsa-miR-483-3p mature miRNA |
Hairpins | |
Sequence | UCACUCCUCUCCUCCCGUCUU |
Evidence |
experimental
cloned [1-2], Northern [1] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:1901202 negative regulation of extracellular matrix assembly |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26747772 | occurs_in CL:0002367 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22223106 | has_input UniProtKB:Q9NR23 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26747772 | has_input UniProtKB:Q13485 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22101077 | has_input UniProtKB:Q8TEW0 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22223106 | has_input UniProtKB:Q9NR23 |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26747772 | has_input UniProtKB:Q13485 |
involved_in | GO:0045599 negative regulation of fat cell differentiation |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0060392 negative regulation of SMAD protein signal transduction |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26747772 | has_input UniProtKB:Q13485 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|