![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ppa-mir-141 |
|||||
Accession | MI0002490 (change log) | ||||
Description | Pan paniscus miR-141 stem-loop | ||||
Gene family | MIPF0000019; mir-8 | ||||
Stem-loop |
u g u u -- u - ugg ua 5' ggcc gccc ggg ccaucuu ccag acaguguu gga uc a |||| |||| ||| ||||||| |||| |||||||| ||| || u 3' uugg uggg ccc gguagaa gguc ugucacaa ccu ag u c g c c au - u cga ug |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ppa-miR-141 |
|
Accession | MIMAT0002201 |
Sequence |
60 - aacacugucugguaaagaugg - 80 |
Evidence | by similarity; MI0000457 |
References |
|
1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|