Stem-loop sequence ppa-mir-141

AccessionMI0002490 (change log)
DescriptionPan paniscus miR-141 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   u    g    u   u       --    u        -   ugg  ua 
5'  ggcc gccc ggg ccaucuu  ccag acaguguu gga   uc  a
    |||| |||| ||| |||||||  |||| |||||||| |||   ||  u
3'  uugg uggg ccc gguagaa  gguc ugucacaa ccu   ag  u
   c    g    c   c       au    -        u   cga  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (panpan1.1; GCA_000258655.2) Overlapping transcripts
chr12: 7011606-7011700 [+]
intergenic
Database links

Mature sequence ppa-miR-141

Accession MIMAT0002201
Sequence

60 - 

aacacugucugguaaagaugg

 - 80

Get sequence
Evidence by similarity; MI0000457

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).