Stem-loop sequence ggo-mir-143

AccessionMI0002550 (change log)
DescriptionGorilla gorilla miR-143 stem-loop
Gene family MIPF0000094; mir-143
Stem-loop
   -gc    c  ccug    c ag      g         g      u  -  ag 
5'    gcag gc    ucuc c  ccugag ugcagugcu caucuc gg uc  u
      |||| ||    |||| |  |||||| ||||||||| |||||| || ||   
3'    cguc ug    agag g  ggacuc augucacga guagag cu ag  u
   cga    u  uuga    a aa      g         a      u  g  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr5: 133115327-133115432 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-143
ggo-mir-143chr5: 133115327-133115432 [+]
ggo-mir-145chr5: 133117057-133117144 [+]
Database links

Mature sequence ggo-miR-143

Accession MIMAT0002258
Sequence

61 - 

ugagaugaagcacuguagcuca

 - 82

Get sequence
Evidence by similarity; MI0000459

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).