Stem-loop sequence ppa-mir-143

AccessionMI0002553 (change log)
DescriptionPan paniscus miR-143 stem-loop
Gene family MIPF0000094; mir-143
Stem-loop
   -gc    cgcccug    c ag      g         g      u  -  ag 
5'    gcag       ucuc c  ccugag ugcagugcu caucuc gg uc  u
      ||||       |||| |  |||||| ||||||||| |||||| || ||   
3'    cguc       agag g  ggacuc augucacga guagag cu ag  u
   cga    uuuuuga    a aa      g         a      u  g  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (panpan1.1; GCA_000258655.2) Overlapping transcripts
chr5: 150864637-150864742 [+]
intergenic
Clustered miRNAs
< 10kb from ppa-mir-143
ppa-mir-143chr5: 150864637-150864742 [+]
ppa-mir-145chr5: 150866378-150866438 [+]
Database links

Mature sequence ppa-miR-143

Accession MIMAT0002261
Sequence

61 - 

ugagaugaagcacuguagcuca

 - 82

Get sequence
Evidence by similarity; MI0000459

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).