Stem-loop sequence mml-mir-32

AccessionMI0002677 (change log)
DescriptionMacaca mulatta miR-32 stem-loop
Gene family MIPF0000069; mir-32
Stem-loop
           ug     u            - uu  c 
5' ggagauau  cacau acuaaguugcau g  gu a
   ||||||||  ||||| |||||||||||| |  ||  
3' cuuuuaua  gugug ugauuuaacgua c  cg c
           gu     -            a uc  g 
Get sequence
Deep sequencing
8920 reads, 22.2 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr15: 30522918-30522987 [+]
intergenic
Database links

Mature sequence mml-miR-32-5p

Accession MIMAT0002385
Sequence

6 - 

uauugcacauuacuaaguugc

 - 26

Get sequence
Deep sequencing8779 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-32-3p

Accession MIMAT0026578
Sequence

48 - 

aauuuagugugugugauauu

 - 67

Get sequence
Deep sequencing138 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).