Stem-loop sequence ptr-mir-32

AccessionMI0002678 (change log)
DescriptionPan troglodytes miR-32 stem-loop
Gene family MIPF0000069; mir-32
Stem-loop
           ug     u            - uu  c 
5' ggagauau  cacau acuaaguugcau g  gu a
   ||||||||  ||||| |||||||||||| |  ||  
3' cuuuuaua  gugug ugauuuaacgua c  cg c
           gu     -            a uc  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr9: 86918371-86918440 [-]
sense
ENSPTRT00000056372 ; TMEM245-201; intron 14
Database links

Mature sequence ptr-miR-32

Accession MIMAT0002386
Sequence

6 - 

uauugcacauuacuaaguugc

 - 26

Get sequence
Evidence by similarity; MI0000090
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).