![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptr-mir-32 |
|||||
Accession | MI0002678 (change log) | ||||
Description | Pan troglodytes miR-32 stem-loop | ||||
Gene family | MIPF0000069; mir-32 | ||||
Stem-loop |
ug u - uu c 5' ggagauau cacau acuaaguugcau g gu a |||||||| ||||| |||||||||||| | || 3' cuuuuaua gugug ugauuuaacgua c cg c gu - a uc g |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
||||
Genome context |
|
||||
Database links |
Mature sequence ptr-miR-32 |
|
Accession | MIMAT0002386 |
Sequence |
6 - uauugcacauuacuaaguugc - 26 |
Evidence | by similarity; MI0000090 |
Predicted targets |
|
References |
|
1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|