Stem-loop sequence sla-mir-32

AccessionMI0002681 (change log)
DescriptionSaguinus labiatus miR-32 stem-loop
Gene family MIPF0000069; mir-32
Stem-loop
           ug     u            - uu  c 
5' ggagauau  cacau acuaaguugcau g  gu a
   ||||||||  ||||| |||||||||||| |  ||  
3' cuuuuaua  gugug ugauuuaacgua c  cg c
           gu     -            a uc  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence sla-miR-32

Accession MIMAT0002389
Sequence

6 - 

uauugcacauuacuaaguugc

 - 26

Get sequence
Evidence by similarity; MI0000090

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).