Stem-loop sequence ggo-mir-92-1

AccessionMI0002970 (change log)
DescriptionGorilla gorilla miR-92-1 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ---cu   uac            c   u           uu 
5'      uuc   acagguugggau ggu gcaaugcugug  u
        |||   |||||||||||| ||| |||||||||||   
3'      gag   uguccggcccug uca cguuaugguau  c
   gguuu   --u            u   -           gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr13: 74168900-74168977 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-92-1
ggo-mir-17chr13: 74168191-74168274 [+]
ggo-mir-18achr13: 74168337-74168407 [+]
ggo-mir-19achr13: 74168477-74168558 [+]
ggo-mir-20achr13: 74168651-74168721 [+]
ggo-mir-19b-1chr13: 74168778-74168864 [+]
ggo-mir-92-1chr13: 74168900-74168977 [+]
Database links

Mature sequence ggo-miR-92

Accession MIMAT0002664
Sequence

48 - 

uauugcacuugucccggccugu

 - 69

Get sequence
Evidence by similarity; MI0000094

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).