Stem-loop sequence ppa-mir-92a-1

AccessionMI0002988 (change log)
DescriptionPan paniscus miR-92a-1 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ---cu   uac            c   u           uu 
5'      uuc   acagguugggau ggu gcaaugcugug  u
        |||   |||||||||||| ||| |||||||||||   
3'      gag   uguccggcccug uca cguuaugguau  c
   gguuu   --u            u   -           gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (panpan1.1; GCA_000258655.2) Overlapping transcripts
chr13: 91708037-91708114 [+]
intergenic
Clustered miRNAs
< 10kb from ppa-mir-92a-1
ppa-mir-17chr13: 91707328-91707411 [+]
ppa-mir-18chr13: 91707474-91707544 [+]
ppa-mir-19achr13: 91707614-91707695 [+]
ppa-mir-20chr13: 91707788-91707858 [+]
ppa-mir-19b-1chr13: 91707915-91708001 [+]
ppa-mir-92a-1chr13: 91708037-91708114 [+]
Database links

Mature sequence ppa-miR-92a

Accession MIMAT0002685
Sequence

48 - 

uauugcacuugucccggccugu

 - 69

Get sequence
Evidence by similarity; MI0000094

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).