Stem-loop sequence ppy-mir-92-1

AccessionMI0002994 (change log)
DescriptionPongo pygmaeus miR-92-1 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ---cu   uac            c   u           uu 
5'      uuc   acagguugggau agu gcaaugcugug  u
        |||   |||||||||||| ||| |||||||||||   
3'      gag   uguccggcccug uca cguuaugguau  c
   gguuu   --u            u   -           gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr13: 93460739-93460816 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-92-1
ppy-mir-17chr13: 93460030-93460113 [+]
ppy-mir-18achr13: 93460176-93460246 [+]
ppy-mir-19achr13: 93460316-93460397 [+]
ppy-mir-20achr13: 93460490-93460560 [+]
ppy-mir-19b-1chr13: 93460617-93460703 [+]
ppy-mir-92-1chr13: 93460739-93460816 [+]
Database links

Mature sequence ppy-miR-92

Accession MIMAT0002692
Sequence

48 - 

uauugcacuugucccggccugu

 - 69

Get sequence
Evidence by similarity; MI0000094

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).