Stem-loop sequence ptr-mir-92-1

AccessionMI0003000 (change log)
DescriptionPan troglodytes miR-92-1 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ---cu   uac            c   u           uu 
5'      uuc   acagguugggau ggu gcaaugcugug  u
        |||   |||||||||||| ||| |||||||||||   
3'      gag   uguccggcccug uca cguuaugguau  c
   gguuu   --u            u   -           gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr13: 77007420-77007497 [+]
sense
ENSPTRT00000054275 ; ptr-mir-92-1-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-92-1
ptr-mir-17chr13: 77006711-77006794 [+]
ptr-mir-18achr13: 77006857-77006927 [+]
ptr-mir-19achr13: 77006997-77007078 [+]
ptr-mir-20achr13: 77007171-77007241 [+]
ptr-mir-19b-1chr13: 77007298-77007384 [+]
ptr-mir-92-1chr13: 77007420-77007497 [+]
Database links

Mature sequence ptr-miR-92

Accession MIMAT0002699
Sequence

48 - 

uauugcacuugucccggccugu

 - 69

Get sequence
Evidence by similarity; MI0000094
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).