Stem-loop sequence mml-mir-92a-1

AccessionMI0003006 (change log)
Previous IDsmml-mir-92
DescriptionMacaca mulatta miR-92a-1 stem-loop
Gene family MIPF0000013; mir-25
Literature search

2 open access papers mention mml-mir-92a-1
(8 sentences)

Stem-loop
   ---cu   uac            c   u           uu 
5'      uuc   acagguugggau ggu gcaaugcugug  u
        |||   |||||||||||| ||| |||||||||||   
3'      gag   uguccggcccug uca cguuaugguau  c
   gguuu   --u            u   -           gu 
Get sequence
Deep sequencing
170264 reads, 1.4e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [2]. The expression of this mature miRNA was validated by Miska et al [1].

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr17: 73096816-73096893 [+]
sense
ENSMMUT00000015929 ; GPC5-201; intron 1
Clustered miRNAs
< 10kb from mml-mir-92a-1
mml-mir-17chr17: 73096107-73096190 [+]
mml-mir-18achr17: 73096253-73096323 [+]
mml-mir-19achr17: 73096393-73096474 [+]
mml-mir-20achr17: 73096567-73096637 [+]
mml-mir-19b-1chr17: 73096694-73096780 [+]
mml-mir-92a-1chr17: 73096816-73096893 [+]
Database links

Mature sequence mml-miR-92a-3p

Accession MIMAT0002706
Previous IDsmml-miR-92
Sequence

48 - 

uauugcacuugucccggccugu

 - 69

Get sequence
Deep sequencing339963 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).