Stem-loop sequence lla-mir-92-1

AccessionMI0003018 (change log)
DescriptionLagothrix lagotricha miR-92-1 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ---cu   uac            c   u           uu 
5'      uuc   acagguugggau ggu gcaaugcugug  u
        |||   |||||||||||| ||| |||||||||||   
3'      gag   uguccggcccug uca cguuaugguau  c
   gguuu   --u            u   -           gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence lla-miR-92

Accession MIMAT0002720
Sequence

48 - 

uauugcacuugucccggccugu

 - 69

Get sequence
Evidence by similarity; MI0000094

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).