Stem-loop sequence ggo-mir-25

AccessionMI0003061 (change log)
DescriptionGorilla gorilla miR-25 stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention ggo-mir-25
(1 sentences)

Stem-loop
       a ug   ag    g     uu g     u   --  ac 
5' ggcc g  uug  aggc gagac  g gcaau gcu  gg  g
   |||| |  |||  |||| |||||  | ||||| |||  ||  c
3' ccgg c  gac  ucug cucug  c cguua cgg  cc  u
       c gu   ag    g     uu a     -   gu  cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr7: 77984485-77984568 [+]
sense
ENSGGOT00000002752 ; MCM7-201; intron 13
Clustered miRNAs
< 10kb from ggo-mir-25
ggo-mir-106bchr7: 77984054-77984135 [+]
ggo-mir-93chr7: 77984281-77984360 [+]
ggo-mir-25chr7: 77984485-77984568 [+]
Database links

Mature sequence ggo-miR-25

Accession MIMAT0002760
Sequence

52 - 

cauugcacuugucucggucuga

 - 73

Get sequence
Evidence by similarity; MI0000082

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).