Stem-loop sequence ppa-mir-25

AccessionMI0003066 (change log)
DescriptionPan paniscus miR-25 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
       a ug   ag    g     uu g     u   --  ac 
5' ggcc g  uug  aggc gagac  g gcaau gcu  gg  g
   |||| |  |||  |||| |||||  | ||||| |||  ||  c
3' ccgg c  gac  ucug cucug  c cguua cgg  cc  u
       c gu   ag    g     uu a     -   gu  cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (panpan1.1; GCA_000258655.2) Overlapping transcripts
chr7: 105562369-105562452 [-]
intergenic
Clustered miRNAs
< 10kb from ppa-mir-25
ppa-mir-106bchr7: 105562802-105562883 [-]
ppa-mir-93chr7: 105562577-105562656 [-]
ppa-mir-25chr7: 105562369-105562452 [-]
Database links

Mature sequence ppa-miR-25

Accession MIMAT0002765
Sequence

52 - 

cauugcacuugucucggucuga

 - 73

Get sequence
Evidence by similarity; MI0000082

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).