Stem-loop sequence ptr-mir-25

AccessionMI0003072 (change log)
DescriptionPan troglodytes miR-25 stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention ptr-mir-25
(1 sentences)

Stem-loop
       a ug   ag    g     uu g     u   --  ac 
5' ggcc g  uug  aggc gagac  g gcaau gcu  gg  g
   |||| |  |||  |||| |||||  | ||||| |||  ||  c
3' ccgg c  gac  ucug cucug  c cguua cgg  cc  u
       c gu   ag    g     uu a     -   gu  cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. The assembled chimp genome sequence forces a single deletion in the 3' region of the chimp mature miRNA with respect to the human and rodent sequences.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr7: 103150814-103150897 [-]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-25
ptr-mir-106bchr7: 103151247-103151328 [-]
ptr-mir-93chr7: 103151022-103151101 [-]
ptr-mir-25chr7: 103150814-103150897 [-]
Database links

Mature sequence ptr-miR-25

Accession MIMAT0002771
Sequence

52 - 

cauugcacuugucucggucug

 - 72

Get sequence
Evidence by similarity; MI0000082
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).