Stem-loop sequence fru-mir-25

AccessionMI0003229 (change log)
DescriptionFugu rubripes miR-25 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
        ug   ag    g     uu g     u   gg ca 
5' gcugg  uug  aggc gagac  g gcaau gcc  c  u
   |||||  |||  |||| |||||  | ||||| |||  |  c
3' cggcc  gac  ucug cucug  c cguua cgg  g  a
        gu   ag    g     uu a     -   ga ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602548.1: 9744555-9744636 [-]
intergenic
Database links

Mature sequence fru-miR-25

Accession MIMAT0002914
Sequence

51 - 

cauugcacuugucucggucuga

 - 72

Get sequence
Evidence by similarity; MI0001922