Stem-loop sequence tni-mir-25

AccessionMI0003230 (change log)
DescriptionTetraodon nigroviridis miR-25 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
        ug   ag    g     uu g     u   gg ca 
5' gcugg  uug  aggc gagac  g gcaau gcc  c  u
   |||||  |||  |||| |||||  | ||||| |||  |  c
3' cggcc  gac  ucug cucug  c cguua cgg  g  a
        gu   ag    g     uu a     -   ga ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
1: 5569529-5569610 [-]
sense
ENSTNIT00000019029 ; mcm7-201; intron 14
Database links

Mature sequence tni-miR-25

Accession MIMAT0002915
Sequence

51 - 

cauugcacuugucucggucuga

 - 72

Get sequence
Evidence by similarity; MI0001922