Stem-loop sequence fru-mir-92-2

AccessionMI0003239 (change log)
DescriptionFugu rubripes miR-92-2 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   -----     g     c   a        gug a 
5'      caggu gggau agu gcaaugcu   c c
        ||||| ||||| ||| ||||||||   |  
3'      guccg cccug uca cguuaugg   g u
   gaugu     g     u   -        -aa g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602547.1: 13072087-13072149 [+]
intergenic
Clustered miRNAs
< 10kb from fru-mir-92-2
fru-mir-17-1HE602547.1: 13071306-13071391 [+]
fru-mir-18HE602547.1: 13071440-13071515 [+]
fru-mir-19aHE602547.1: 13071578-13071658 [+]
fru-mir-19bHE602547.1: 13071933-13071995 [+]
fru-mir-92-2HE602547.1: 13072087-13072149 [+]
Database links

Mature sequence fru-miR-92

Accession MIMAT0002924
Sequence

38 - 

uauugcacuugucccggccugu

 - 59

Get sequence
Evidence by similarity; MI0001951