Stem-loop sequence tni-mir-92-2

AccessionMI0003240 (change log)
DescriptionTetraodon nigroviridis miR-92-2 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   cuuccc        g    ug   a        gugu 
5'       auacaggu ggga  agu gcaaugcu    a
         |||||||| ||||  ||| ||||||||    c
3'       uguguccg cccu  uca cguuaugg    u
   ----ga        g    gu   -        agga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
5: 8188106-8188177 [-]
intergenic
Clustered miRNAs
< 10kb from tni-mir-92-2
tni-mir-17-15: 8188854-8188939 [-]
tni-mir-185: 8188729-8188804 [-]
tni-mir-19a5: 8188589-8188669 [-]
tni-mir-19b5: 8188259-8188335 [-]
tni-mir-92-25: 8188106-8188177 [-]
Database links

Mature sequence tni-miR-92

Accession MIMAT0002925
Sequence

47 - 

uauugcacuugucccggccugu

 - 68

Get sequence
Evidence by similarity; MI0001951