Stem-loop sequence fru-mir-200a

AccessionMI0003303 (change log)
DescriptionFugu rubripes miR-200a stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   ---u       uc    -     c       c    uugu  u 
5'     cucagga  cauc uuacc gacagug ugga    ac a
       |||||||  |||| ||||| ||||||| ||||    ||  
3'     gggucuu  guag aaugg cugucac aucu    ug c
   cagu       uu    c     u       a    -ugu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602537.1: 1332406-1332488 [-]
intergenic
Clustered miRNAs
< 10kb from fru-mir-200a
fru-mir-200bHE602537.1: 1332580-1332656 [-]
fru-mir-200aHE602537.1: 1332406-1332488 [-]
fru-mir-429HE602537.1: 1331221-1331296 [-]
Database links

Mature sequence fru-miR-200a

Accession MIMAT0002981
Sequence

50 - 

uaacacugucugguaacgaugu

 - 71

Get sequence
Evidence by similarity; MI0002037