Stem-loop sequence tni-mir-200a

AccessionMI0003304 (change log)
DescriptionTetraodon nigroviridis miR-200a stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   --    -     u       c    uuau  u 
5'   cauc uuacc gacagug ugga    ac a
     |||| ||||| ||||||| ||||    ||  
3'   guag aaugg cugucac aucu    ug c
   uu    c     u       a    -ugu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
Un_random: 2991451-2991512 [+]
intergenic
Clustered miRNAs
< 10kb from tni-mir-200a
tni-mir-200bUn_random: 2991281-2991357 [+]
tni-mir-200aUn_random: 2991451-2991512 [+]
tni-mir-429Un_random: 2992653-2992739 [+]
Database links

Mature sequence tni-miR-200a

Accession MIMAT0002982
Sequence

40 - 

uaacacugucugguaacgaugu

 - 61

Get sequence
Evidence by similarity; MI0002037