Stem-loop sequence gga-mir-367

AccessionMI0003712 (change log)
DescriptionGallus gallus miR-367 stem-loop
Gene family MIPF0000162; mir-367
Literature search

3 open access papers mention gga-mir-367
(4 sentences)

Stem-loop
   agg   a            ca     c    uugua 
5'    cua uacuguugcuaa  ugcaa ucug     u
      ||| ||||||||||||  ||||| ||||      
3'    ggu gugguaacgauu  acguu aggu     a
   -ca   a            uc     a    uaaaa 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 57457315-57457387 [+]
antisense
ENSGALT00000019679 ; LARP7-201; intron 8
Clustered miRNAs
< 10kb from gga-mir-367
gga-mir-302bchr4: 57456279-57456350 [+]
gga-mir-302cchr4: 57456541-57456605 [+]
gga-mir-1811chr4: 57456663-57456743 [+]
gga-mir-302achr4: 57456844-57456910 [+]
gga-mir-302dchr4: 57457179-57457247 [+]
gga-mir-367chr4: 57457315-57457387 [+]
Database links

Mature sequence gga-miR-367

Accession MIMAT0003369
Sequence

47 - 

aauugcacuuuagcaauggug

 - 67

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0003531
Predicted targets