Accession | MIMAT0003879 |
Description | hsa-miR-758-3p mature miRNA |
Hairpins | |
Sequence | UUUGUGACCUGGUCCACUAACC |
Evidence |
experimental
cloned [1-2], SOLiD [3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21885853 | has_input UniProtKB:O95477 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25008898 | has_input UniProtKB:O15455 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25008898 | has_input UniProtKB:Q9NYK1 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21885853 | has_input UniProtKB:O95477 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21885853 | has_input UniProtKB:P05019 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25008898 | has_input UniProtKB:O15455 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25008898 | has_input UniProtKB:Q9NYK1 |
involved_in | GO:0045087 innate immune response |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25008898 | |
involved_in | GO:0071404 cellular response to low-density lipoprotein particle stimulus |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21885853 | occurs_in CL:0000235 |
involved_in | GO:0090370 negative regulation of cholesterol efflux |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21885853 | occurs_in CL:0000235 |
involved_in | GO:0098586 cellular response to virus |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25008898 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|