Stem-loop sequence ppt-MIR1215

AccessionMI0004714 (change log)
DescriptionPhyscomitrella patens miR1215 stem-loop
Stem-loop
       a   u       -c    u  a           g       caacuugaacagcauucg 
5' cgug agg acuggag  ucau gc aaacuguauac auccuuu                  a
   |||| ||| |||||||  |||| || ||||||||||| |||||||                   
3' guac ucc ugaccuc  ggug cg uuugacauaug uaggaga                  a
       a   c       aa    u  c           g       cucguuaucgguguucga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr17: 11853573-11853699 [+]
intergenic
Database links

Mature sequence ppt-miR1215

Accession MIMAT0003904
Sequence

18 - 

ucauugcaaaacuguauacga

 - 38

Get sequence
Evidence experimental; Northern [1], 454 [2]

References

1
PMID:16824179 "Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss" Talmor-Neiman M, Stav R, Frank W, Voss B, Arazi T Plant J. 47:25-37(2006).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).