Stem-loop sequence sme-mir-281

AccessionMI0005172 (change log)
DescriptionSchmidtea mediterranea miR-281 stem-loop
Stem-loop
   uuac     aca         -         g   ca u   -    c 
5'     agcuu   augaagagc uauucauga gug  g aua auga a
       |||||   ||||||||| ||||||||| |||  | ||| |||| a
3'     ucgaa   uacuucucg auagguacu uac  c ugu uacu u
   aaua     -aa         u         g   cc u   c    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig6524: 4460-4555 [+]
intergenic
Database links

Mature sequence sme-miR-281-5p

Accession MIMAT0004012
Previous IDssme-miR-281*
Sequence

14 - 

ugaagagcuauucaugaggu

 - 33

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

Mature sequence sme-miR-281-3p

Accession MIMAT0004013
Previous IDssme-miR-281
Sequence

65 - 

ugucauggauaugcucuuc

 - 83

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).