Stem-loop sequence osa-MIR815a

AccessionMI0005242 (change log)
DescriptionOryza sativa miR815a stem-loop
Gene family MIPF0000349; MIR815
Literature search

1 open access papers mention osa-MIR815a
(1 sentences)

Stem-loop
            a   -     uu        -a     a   c 
5' uuuuuuuag cuc uuaau  cuuuuucu  ggaug acu u
   ||||||||| ||| |||||  ||||||||  ||||| ||| u
3' agagggguu gag aguua  ggaagagg  uuugu ugg a
            a   g     gg        ag     g   g 
Get sequence
Deep sequencing
2282 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR815 was misnamed miR574 by Luo et al [1]. The identified mature sequence maps many times to the rice genome, and overlaps annotated transposon and siRNA loci. This entry may therefore represent an siRNA rather than a miRNA, and may be removed from future database releases.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 29746632-29746714 [+]
intergenic
Database links

Mature sequence osa-miR815a

Accession MIMAT0004058
Sequence

59 - 

aaggggauugaggagauuggg

 - 79

Get sequence
Deep sequencing1898 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links

References

1