Stem-loop sequence osa-MIR815b

AccessionMI0005243 (change log)
DescriptionOryza sativa miR815b stem-loop
Gene family MIPF0000349; MIR815
Literature search

2 open access papers mention osa-MIR815b
(2 sentences)

Stem-loop
                             a              u  uu       cuc      ag c 
5' cuaaugguucaccucguuuugcguau uucccaaucuucuc au  ccuucuc   aaacac  c u
   |||||||||||||||||||||||||| |||||||||||||| ||  |||||||   ||||||  |  
3' gauuaccgaguggagcaaaaugcaua aaggguuagaggag ua  ggaagag   uuugug  g g
                             g              u  gg       ---      -a g 
Get sequence
Deep sequencing
5061 reads, 900 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

miR815 was misnamed miR574 by Luo et al [1]. The identified mature sequence maps many times to the rice genome, and overlaps annotated transposon and siRNA loci. This entry may therefore represent an siRNA rather than a miRNA, and may be removed from future database releases.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 14992226-14992355 [+]
intergenic
Database links

Mature sequence osa-miR815b

Accession MIMAT0004059
Sequence

81 - 

aaggggauugaggagauuggg

 - 101

Get sequence
Deep sequencing3558 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links

References

1