Stem-loop sequence osa-MIR815c

AccessionMI0005244 (change log)
DescriptionOryza sativa miR815c stem-loop
Gene family MIPF0000349; MIR815
Literature search

2 open access papers mention osa-MIR815c
(2 sentences)

Stem-loop
         -c       --      c a      cauuuagccggcuuauagcc 
5' cuucuc  ucucuuc  ucuccu c ccucag                    u
   ||||||  |||||||  |||||| | ||||||                     
3' gaaggg  agaggag  agggga g ggaguu                    a
         uu       uu      a a      ugugugggaaucuccuucau 
Get sequence
Deep sequencing
2457 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

miR815 was misnamed miR574 by Luo et al [1]. The identified mature sequence maps many times to the rice genome, and overlaps annotated transposon and siRNA loci. This entry may therefore represent an siRNA rather than a miRNA, and may be removed from future database releases.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 5426885-5426987 [-]
intergenic
Database links

Mature sequence osa-miR815c

Accession MIMAT0004060
Sequence

80 - 

aaggggauugaggagauuggg

 - 100

Get sequence
Deep sequencing1964 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links

References

1