Stem-loop sequence osa-MIR821a

AccessionMI0005266 (change log)
DescriptionOryza sativa miR821a stem-loop
Gene family MIPF0000350; MIR821
Literature search

1 open access papers mention osa-MIR821a
(5 sentences)

Stem-loop
      a    c                  a                          a            gg c          ac   a     a      c            a  g      cucuuauc     u 
5' gau ucag ugaaaaagucaucaacaa aaaguugaauaacucaucaagaucua aacuuuuauuuu  u auuucuucau  gac aagug uaguaa auuguucacaga uu acauau        ugguu u
   ||| |||| |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||  | ||||||||||  ||| ||||| |||||| |||||||||||| || ||||||        ||||| a
3' cua aguu acuuuuucaguaguuguu uuucaacuuauugaguaguucuagau uugaaaauaaaa  a uaaagaagua  cug uuuac aucauu uaauaaguguuu aa uguaua        aucaa u
      a    a                  g                          a            aa -          ga   c     a      a            a  a      uacacaau     a 
Get sequence
Deep sequencing
147 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR821 was misnamed miR584 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 22974225-22974498 [+]
intergenic
Database links

Mature sequence osa-miR821a

Accession MIMAT0004082
Sequence

15 - 

aagucaucaacaaaaaaguugaau

 - 38

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; cloned [1], Northern [1]

References

1