Stem-loop sequence osa-MIR821b

AccessionMI0005267 (change log)
DescriptionOryza sativa miR821b stem-loop
Gene family MIPF0000350; MIR821
Literature search

1 open access papers mention osa-MIR821b
(6 sentences)

Stem-loop
            u                       a               a                     uuu             c       a  uua           cacaaauuuuacauauauguguuaaaguuu 
5' cuaaaugau ucaauugaaaaagucaucaacaa aaaguugaauaacuu ucaagaucuaaaacuuuuauu   guuauuucuucau cgacgaa ug   guaauauuauu                              a
   ||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||   ||||||||||||| ||||||| ||   |||||||||||                              u
3' gauuuacua aguugacuuuuucaguaguuguu uuucaacuuauugag aguucuagauuuugaaaauaa   caauaaagaagua gcuguuu ac   cauuguaauaa                              a
            u                       g               a                     cac             u       c  uac           auauuuuaacaguauagagaauagaccaaa 
Get sequence
Deep sequencing
116 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR821 was misnamed miR584 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 16417225-16417511 [+]
intergenic
Database links

Mature sequence osa-miR821b

Accession MIMAT0004083
Sequence

21 - 

aagucaucaacaaaaaaguugaau

 - 44

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; cloned [1], Northern [1]

References

1