Stem-loop sequence osa-MIR821c

AccessionMI0005268 (change log)
DescriptionOryza sativa miR821c stem-loop
Gene family MIPF0000350; MIR821
Literature search

1 open access papers mention osa-MIR821c
(5 sentences)

Stem-loop
       c                  a                    c                  g   a         ac         a   u  c            a  g     acucuuauc     u 
5' ucaa ugaaaaagucaucaacaa aaaguugaauaacucaucaa aucuaaaacuuuuauuuu guu uuucuucau  gacaaagug uag aa auuauucacaaa uu acaua         ugguu u
   |||| |||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||| |||||||||  ||||||||| ||| || |||||||||||| || |||||         ||||| a
3' aguu acuuuuucaguaguuguu uuucaacuuauugaguaguu uagauuuugaaaauaaaa caa aaagaagua  cuguuuuac auc uu uaauaaguguuu aa uguau         aucaa u
       a                  g                    c                  a   c         ga         a   -  u            a  a     auacacaau     a 
Get sequence
Deep sequencing
63 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR821 was misnamed miR584 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 19925129-19925394 [-]
intergenic
Database links

Mature sequence osa-miR821c

Accession MIMAT0004084
Sequence

11 - 

aagucaucaacaaaaaaguugaau

 - 34

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]

References

1