Stem-loop sequence mdo-mir-142

AccessionMI0005301 (change log)
DescriptionMonodelphis domestica miR-142 stem-loop
Gene family MIPF0000084; mir-142
Stem-loop 
   g  g   c           a         ---ua   g 
5'  ca uca ccauaaaguag aagcacuac     aca c
    || ||| ||||||||||| |||||||||     |||  
3'  gu agu gguauuucauc uuugugaug     ugu a
   -  g   a           c         uggga   a
Get sequence
Deep sequencing
34986 reads, 380 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 174133935-174134008 [+]
intergenic
Database links

Mature sequence mdo-miR-142

Accession MIMAT0004112
Sequence

46 -  

uguaguguuuccuacuuuaugga

 - 68

Get sequence
Deep sequencing17502 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1]
Database links
Predicted targets

References

1
PMID:17965199 "In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica" Devor EJ, Samollow PB J Hered. 99:66-72(2008).