Stem-loop sequence mdo-mir-200a

AccessionMI0005346 (change log)
DescriptionMonodelphis domestica miR-200a stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
     --g     g        -             c    uuuuu 
5' gg   ccucu ugggcauc uuacuagacagug ugga     g
   ||   ||||| |||||||| ||||||||||||| ||||     g
3' cc   ggaga auuuguag aauggucugucac aucu     a
     aag     a        c             a    caugu 
Get sequence
Deep sequencing
41891 reads, 540 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 389169611-389169696 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-200a
mdo-mir-200bchr4: 389166960-389167027 [+]
mdo-mir-200achr4: 389169611-389169696 [+]
mdo-mir-429chr4: 389175425-389175496 [+]
Database links

Mature sequence mdo-miR-200a-5p

Accession MIMAT0004157
Previous IDsmdo-miR-200a*
Sequence

14 - 

caucuuacuagacagugcugga

 - 35

Get sequence
Deep sequencing290 reads, 3 experiments
Evidence by similarity; MI0001249
Predicted targets

Mature sequence mdo-miR-200a-3p

Accession MIMAT0004158
Previous IDsmdo-miR-200a
Sequence

51 - 

uaacacugucugguaacgaugu

 - 72

Get sequence
Deep sequencing41599 reads, 5 experiments
Evidence by similarity; MI0001249
Database links
Predicted targets

References

1