Stem-loop sequence mdo-mir-92a-1

AccessionMI0005359 (change log)
DescriptionMonodelphis domestica miR-92a-1 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ---cu   uac            c   u        gu uc 
5'      uuc   acagguugggau agu gcaaugcu  g  u
        |||   |||||||||||| ||| ||||||||  |   
3'      gag   uguccggcccug uca cguuauga  u  g
   gguuu   --u            u   -        ug cu 
Get sequence
Deep sequencing
97940 reads, 1.4e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 108468191-108468268 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-92a-1
mdo-mir-17chr7: 108468894-108468978 [-]
mdo-mir-18achr7: 108468760-108468831 [-]
mdo-mir-19achr7: 108468609-108468689 [-]
mdo-mir-20achr7: 108468430-108468531 [-]
mdo-mir-19b-1chr7: 108468305-108468393 [-]
mdo-mir-92a-1chr7: 108468191-108468268 [-]
Database links

Mature sequence mdo-miR-92a-1-5p

Accession MIMAT0026709
Sequence

11 - 

agguugggaucaguugcaaugcu

 - 33

Get sequence
Deep sequencing168 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-92a-3p

Accession MIMAT0004171
Sequence

48 - 

uauugcacuugucccggccugu

 - 69

Get sequence
Deep sequencing160564 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).