Stem-loop sequence bmo-mir-305

AccessionMI0004985 (change log)
DescriptionBombyx mori miR-305 stem-loop
Gene family MIPF0000158; mir-305
Literature search

7 open access papers mention bmo-mir-305
(28 sentences)

Stem-loop
   c        -    cccau         u       u    u   c 
5'  gaccgccg cacg     uguacuuca caggugc cugg gau a
    |||||||| ||||     ||||||||| ||||||| |||| |||  
3'  uuggcggc gugc     acaugaggu guucgcg gacc uug u
   a        u    cauuc         u       -    -   a 
Get sequence
Deep sequencing
1016 reads, 100 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582013.1: 1926822-1926912 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-305
bmo-mir-275NW_004582013.1: 1926698-1926783 [+]
bmo-mir-305NW_004582013.1: 1926822-1926912 [+]
Database links

Mature sequence bmo-miR-305-5p

Accession MIMAT0004207
Previous IDsbmo-miR-305
Sequence

17 - 

auuguacuucaucaggugcucug

 - 39

Get sequence
Deep sequencing880 reads, 3 experiments
Evidence experimental; Illumina [3]
Database links

Mature sequence bmo-miR-305-3p

Accession MIMAT0015236
Previous IDsbmo-miR-305*
Sequence

55 - 

ggcgcuuguuggaguacacuu

 - 75

Get sequence
Deep sequencing136 reads, 3 experiments
Evidence experimental; Illumina [3]
Database links

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).