Stem-loop sequence cbr-mir-235a

AccessionMI0005428 (change log)
Previous IDscbr-mir-235
DescriptionCaenorhabditis briggsae miR-235 stem-loop
Gene family MIPF0000367; mir-235
Stem-loop
   ucc    c     u  cc  u    u     -  -    acu 
5'    gauc ggcca gg  aa ugca auauu gc uuuu   u
      |||| ||||| ||  || |||| ||||| || ||||    
3'    cuag ccggu cc  uu acgu uauaa cg aaaa   u
   agu    a     -  cu  c    -     g  u    cuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrI: 10817705-10817786 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-235a
cbr-mir-235bchrI: 10817837-10817939 [-]
cbr-mir-235achrI: 10817705-10817786 [-]
Database links

Mature sequence cbr-miR-235a

Accession MIMAT0004295
Previous IDscbr-miR-235
Sequence

56 - 

uauugcacuuucccuggccaga

 - 77

Get sequence
Evidence by similarity; MI0000310

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).