Stem-loop sequence cbr-mir-392

AccessionMI0005432 (change log)
DescriptionCaenorhabditis briggsae miR-392 stem-loop
Gene family MIPF0000372; mir-392
Stem-loop
   aaauc   c  uu        u       u     g     aaa  aa 
5'      cug au  aucugaca cucacau auuga gauau   cu  a
        ||| ||  |||||||| ||||||| ||||| |||||   ||   
3'      gac ua  uagauugu gagugua uagcu cuaua   ga  u
   -uuua   -  -u        c       c     a     -aa  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 19329031-19329124 [+]
intergenic
Database links

Mature sequence cbr-miR-392

Accession MIMAT0004299
Sequence

58 - 

uaucaucgaucaugugagcugu

 - 79

Get sequence
Evidence by similarity; MI0000819

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).