Stem-loop sequence rrv-miR-rR1-4

AccessionMI0005721 (change log)
DescriptionRhesus monkey rhadinovirus miR-rR1-4 stem-loop
Stem-loop
      u  u       g           c    c   ---------     gu 
5' ccg gu gugauuu gggagggcggu agcg gcg         uuccc  g
   ||| || ||||||| ||||||||||| |||| |||         |||||  u
3' ggc cg cauuaga cccucccgcca uugc cgc         aaggg  u
      u  u       g           a    u   uauauguau     au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:AF210726.1) Overlapping transcripts
AF210726.1: 112235-112330 [-]
intergenic
Clustered miRNAs
< 10kb from rrv-miR-rR1-4
rrv-miR-rR1-1AF210726.1: 116303-116380 [-]
rrv-miR-rR1-2AF210726.1: 114328-114410 [-]
rrv-miR-rR1-3AF210726.1: 112664-112767 [-]
rrv-miR-rR1-4AF210726.1: 112235-112330 [-]
rrv-miR-rR1-5AF210726.1: 111474-111557 [-]
rrv-miR-rR1-6AF210726.1: 111174-111245 [-]
rrv-miR-rR1-7AF210726.1: 111055-111132 [-]
Database links

Mature sequence rrv-miR-rR1-4-5p

Accession MIMAT0004410
Previous IDsrrv-miR-rR1-4
Sequence

14 - 

uggggagggcggucagcgcgcg

 - 35

Get sequence
Evidence experimental; cloned [1]

Mature sequence rrv-miR-rR1-4-3p

Accession MIMAT0004411
Previous IDsrrv-miR-rR1-4*
Sequence

64 - 

cucguuaaccgcccucccgaga

 - 85

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17451774 "Cloning and analysis of microRNAs encoded by the primate gamma-herpesvirus rhesus monkey rhadinovirus" Schafer A, Cai X, Bilello JP, Desrosiers RC, Cullen BR Virology. 364:21-27(2007).