Stem-loop sequence rrv-miR-rR1-6

AccessionMI0005723 (change log)
DescriptionRhesus monkey rhadinovirus miR-rR1-6 stem-loop
Stem-loop
            c      a        ca     aaau 
5' gcggugaac gcggaa ggugugca  ucgua    c
   ||||||||| |||||| ||||||||  |||||     
3' cgucauuug cgcuuu ccgcaugu  agcgu    a
            a      c        --     cauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:AF210726.1) Overlapping transcripts
AF210726.1: 111174-111245 [-]
intergenic
Clustered miRNAs
< 10kb from rrv-miR-rR1-6
rrv-miR-rR1-1AF210726.1: 116303-116380 [-]
rrv-miR-rR1-2AF210726.1: 114328-114410 [-]
rrv-miR-rR1-3AF210726.1: 112664-112767 [-]
rrv-miR-rR1-4AF210726.1: 112235-112330 [-]
rrv-miR-rR1-5AF210726.1: 111474-111557 [-]
rrv-miR-rR1-6AF210726.1: 111174-111245 [-]
rrv-miR-rR1-7AF210726.1: 111055-111132 [-]
Database links

Mature sequence rrv-miR-rR1-6-5p

Accession MIMAT0004413
Previous IDsrrv-miR-rR1-6
Sequence

10 - 

cgcggaaaggugugcacaucgua

 - 32

Get sequence
Evidence experimental; cloned [1]

Mature sequence rrv-miR-rR1-6-3p

Accession MIMAT0004414
Previous IDsrrv-miR-rR1-6*
Sequence

45 - 

cgauguacgcccuuucgcagu

 - 65

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17451774 "Cloning and analysis of microRNAs encoded by the primate gamma-herpesvirus rhesus monkey rhadinovirus" Schafer A, Cai X, Bilello JP, Desrosiers RC, Cullen BR Virology. 364:21-27(2007).