Stem-loop sequence ame-mir-92a

AccessionMI0005745 (change log)
DescriptionApis mellifera miR-92a stem-loop
Gene family MIPF0000013; mir-25
Literature search

3 open access papers mention ame-mir-92a
(7 sentences)

Stem-loop
   -u   uu     agaa         a   uu   a       ucgu   ga 
5'   uau  ugcau    gauaggccg gau  gug caauguu    gau  u
     |||  |||||    ||||||||| |||  ||| |||||||    |||   
3'   aua  acgua    cuauccggc cug  cac guuauaa    cua  g
   uu   uu     -agg         c   uu   -       -cuu   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000066.5: 8056052-8056151 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-92a
ame-mir-92aCM000066.5: 8056052-8056151 [+]
ame-mir-92cCM000066.5: 8056244-8056325 [+]
Database links

Mature sequence ame-miR-92a-3p

Accession MIMAT0004435
Sequence

64 - 

auugcacuugucccggccuau

 - 84

Get sequence
Evidence experimental; RTPCR [2], Illumina [3]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
3
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).