Stem-loop sequence mdv2-mir-M24

AccessionMI0005892 (change log)
DescriptionMareks disease virus type 2 miR-M24 stem-loop
Stem-loop
           u    u     gc     gu   au 
5' ccauuuuu cccu acggu  cugac  cgu  u
   |||||||| |||| |||||  |||||  |||   
3' gguagaaa ggga ugccg  gauug  gca  u
           -    c     ua     --   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdv2-miR-M24-5p

Accession MIMAT0012543
Previous IDsmdv2-miR-M24*
Sequence

5 - 

uuuuucccuuacggugccugacg

 - 27

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mdv2-miR-M24-3p

Accession MIMAT0004468
Previous IDsmdv2-miR-M24
Sequence

42 - 

uuagaugccgucagggaaagau

 - 63

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:17459919 "Marek's disease virus type 2 (MDV-2)-encoded microRNAs show no sequence conservation with those encoded by MDV-1" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Sewer A, Zavolan M, Nair V J Virol. 81:7164-7170(2007).
2
PMID:19328516 "MicroRNAs of Gallid and Meleagrid herpesviruses show generally conserved genomic locations and are virus-specific" Waidner LA, Morgan RW, Anderson AS, Bernberg EL, Kamboj S, Garcia M, Riblet SM, Ouyang M, Isaacs GK, Markis M, Meyers BC, Green PJ, Burnside J Virology. 388:128-136(2009).