Stem-loop sequence mdv2-mir-M30

AccessionMI0005898 (change log)
DescriptionMareks disease virus type 2 miR-M30 stem-loop
Stem-loop
   --------cacaa          g   -      -u  c 
5'              cacucccucg acg cagcag  gu u
                |||||||||| ||| ||||||  ||  
3'              gugagggagc ugc gucguc  cg g
   gagcgcaccgcuc          g   a      uu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdv2-miR-M30-5p

Accession MIMAT0004477
Previous IDsmdv2-miR-M30
Sequence

3 - 

caacacucccucggacgcagca

 - 24

Get sequence
Evidence experimental; cloned [1], Illumina [2]

Mature sequence mdv2-miR-M30-3p

Accession MIMAT0012546
Previous IDsmdv2-miR-M30*
Sequence

40 - 

cugacgugcgagggagugcuc

 - 60

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17459919 "Marek's disease virus type 2 (MDV-2)-encoded microRNAs show no sequence conservation with those encoded by MDV-1" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Sewer A, Zavolan M, Nair V J Virol. 81:7164-7170(2007).
2
PMID:19328516 "MicroRNAs of Gallid and Meleagrid herpesviruses show generally conserved genomic locations and are virus-specific" Waidner LA, Morgan RW, Anderson AS, Bernberg EL, Kamboj S, Garcia M, Riblet SM, Ouyang M, Isaacs GK, Markis M, Meyers BC, Green PJ, Burnside J Virology. 388:128-136(2009).