Mature hsa-miR-10a-3p
| Accession | MIMAT0004555 |
| Description | hsa-miR-10a-3p mature miRNA |
| Hairpins | |
| Sequence | CAAAUUCGUAUCUAGGGGAAUA |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| involved_in | GO:0016525 negative regulation of angiogenesis |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
| involved_in | GO:0043537 negative regulation of blood vessel endothelial cell migration |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
| involved_in | GO:0110059 negative regulation of blood vessel endothelial cell differentiation |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
| involved_in | GO:1903769 negative regulation of cell proliferation in bone marrow |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
| involved_in | GO:2000774 positive regulation of cellular senescence |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:0002092 |
