Stem-loop sequence rno-mir-124-3

Accession

MI0000892 (change log)

Previous IDs

rno-mir-124a-3

Description

Rattus norvegicus miR-124-3 stem-loop

Gene family

MIPF0000021; mir-124

Literature search

86 open access papers mention rno-mir-124-3
(383 sentences)

Stem-loop

   u    -   c    - c        a   ga        uaaug 
5'  gagg gcc cucu g guguucac gcg  ccuugauu     u
    |||| ||| |||| | |||||||| |||  ||||||||      
3'  cucc cgg gaga c cguaagug cgc  ggaauuaa     c
   c    g   a    a -        g   ac        cauau 

Deep sequencing

1257442 reads, 1.19e+03 reads per million, 377 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr3: 176406205-176406291 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:Mir124-3
• miRBase Tracker:MI0000892

Mature sequence rno-miR-124-5p

• Accession: MIMAT0004728
• Previous IDs: rno-miR-124*
• Sequence: 15 - cguguucacagcggaccuugau - 36
• Deep sequencing: 29153 reads, 132 experiments
• Evidence: experimental; cloned [3], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-124-5p
  • miRDB:rno-miR-124-5p
  • microrna.org:rno-miR-124-5p

Mature sequence rno-miR-124-3p

• Accession: MIMAT0000828
• Previous IDs: rno-miR-124a;rno-miR-124
• Sequence: 53 - uaaggcacgcggugaaugcc - 72
• Deep sequencing: 3743265 reads, 376 experiments
• Evidence: experimental; cloned [1-3], Northern [1], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-124-3p
  • miRDB:rno-miR-124-3p
  • microrna.org:rno-miR-124-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).