![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-653 |
||||||
Accession | MI0005557 (change log) | |||||
Symbol | MGI:Mir653 | |||||
Description | Mus musculus miR-653 stem-loop | |||||
Gene family | MIPF0000435; mir-653 | |||||
Literature search |
2 open access papers mention mmu-mir-653 | |||||
Stem-loop |
-- u u c caa c 5' cauucuu caguguugaaacaa cucua ugaac gcu c ||||||| |||||||||||||| ||||| ||||| ||| 3' gugagga guuaugacuuuguu gaggu acuug cga a uc c u c -ag a |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown in human and rat [2]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-653-5p |
|
Accession | MIMAT0004943 |
Previous IDs | mmu-miR-653 |
Sequence |
11 - guguugaaacaaucucuacug - 31 |
Deep sequencing | 698 reads, 33 experiments |
Evidence | experimental; RAKE [1], 454 [3], Illumina [4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-653-3p |
|
Accession | MIMAT0017284 |
Previous IDs | mmu-miR-653* |
Sequence |
51 - uucacuggaguuuguuucagu - 71 |
Deep sequencing | 50 reads, 16 experiments |
Evidence | experimental; Illumina [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:17989215
"RNA sequence analysis defines Dicer's role in mouse embryonic stem cells"
Proc Natl Acad Sci U S A. 104:18097-18102(2007).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|