Stem-loop sequence ppt-MIR900

AccessionMI0005683 (change log)
DescriptionPhyscomitrella patens miR900 stem-loop
Stem-loop
   gaguaagauagagcaaaacgcagccaaagaagagucguccaguagccgacguagauggcaugcaac       u   -   ga  cc ---g    aaga    ----                                 ua u 
5'                                                                   uccaacu cgc aau  ua  c    cucu    ucgc    ggucuucccagguacaagaacacagcucaccag  g c
                                                                     ||||||| ||| |||  ||  |    ||||    ||||    |||||||||||||||||||||||||||||||||  |  
3'                                                                   agguuga gcg uua  au  g    gaga    agcg    ccagaaggguccauguucuugugucgagugguc  c g
   -----------------------------------------------------------aagccua       -   g   ag  aa auaa    ----    acca                                 gc a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr13: 11882003-11882222 [+]
intergenic
Database links

Mature sequence ppt-miR900-5p

Accession MIMAT0004961
Sequence

106 - 

ucccagguacaagaacacagc

 - 126

Get sequence
Evidence experimental; 454 [2]

Mature sequence ppt-miR900-3p

Accession MIMAT0004370
Previous IDsppt-miR900
Sequence

153 - 

uguguucuuguaccugggaag

 - 173

Get sequence
Evidence experimental; cloned [1], 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).