Stem-loop sequence dme-mir-1015

AccessionMI0005876 (change log)
DescriptionDrosophila melanogaster miR-1015 stem-loop
Stem-loop
   -- ug  --u    c   aguuagcuuggcuga 
5'   g  ag   gaug ucc               g
     |  ||   |||| |||               u
3'   c  uc   cuac agg               g
   ga gu  ucu    -   guccugaauuuagga 
Get sequence
Deep sequencing
2359 reads, 12.2 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 24339232-24339295 [+]
sense
FBtr0084606 ; CG6432-RA; intron 3
Database links

Mature sequence dme-miR-1015-3p

Accession MIMAT0005028
Previous IDsdme-miR-1015
Sequence

43 - 

uccugggacaucucucuugcag

 - 64

Get sequence
Deep sequencing2212 reads, 40 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).