Stem-loop sequence ppt-MIR1039

AccessionMI0005998 (change log)
DescriptionPhyscomitrella patens miR1039 stem-loop
Stem-loop
   --aggag   auu u u       a                 u             u      a  u 
5'        cuu   g g cagccac uuagggucuuugggucu ucucuccugaaaa guuaag gc u
          |||   | | ||||||| ||||||||||||||||| ||||||||||||| |||||| ||  
3'        ggg   c c guuggug aguucuaggaacucggg agaggggacuuuu uaauuc cg g
   aauagua   -gu - -       a                 c             -      g  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr08: 247422-247551 [-]
intergenic
Database links

Mature sequence ppt-miR1039-5p

Accession MIMAT0005148
Sequence

30 - 

ucuuugggucuuucucuccug

 - 50

Get sequence
Evidence experimental; 454 [1]

Mature sequence ppt-miR1039-3p

Accession MIMAT0005149
Sequence

84 - 

ggggagacgggcucaaggauc

 - 104

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).